View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16507_high_22 (Length: 217)
Name: NF16507_high_22
Description: NF16507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16507_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 42222928 - 42223121
Alignment:
| Q |
16 |
gcattgtggtcttctagtttggcttttcctctatttgagatttattgactactttagtttacatgttattgcgcaggtgaacgtttaagcccttgggtgg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42222928 |
gcattgtggtcttctagtttggcttttcctctattcgagatttattgactactttagtttacatgttattgcgcaggtgaacgtttaagcccttgggtgg |
42223027 |
T |
 |
| Q |
116 |
ccgctggatgttttacaatgggcatatcaattctattcttctgaaccttactctgacttgaaatggttccattttcctttccattcttctcact |
209 |
Q |
| |
|
||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
42223028 |
ccgttggatgttttacaatgggcgtatcaattctattcttctgaaccttactctgacttgaaatgtttccattttcctttccattcttttcact |
42223121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University