View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16507_low_19 (Length: 396)
Name: NF16507_low_19
Description: NF16507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16507_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 31879571 - 31879354
Alignment:
| Q |
18 |
tatatttctgtcaatattgtcctagttttgcacttaagaggataggaggagaaatattgtatttaggctctgtttaggggtggccttcgggaaatagcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31879571 |
tatatttctgtcaatattgtcctagttttgcacttaagaggataggaggagaaatattgtatttaggctctgtttgggggtggccttcgggaaatagcaa |
31879472 |
T |
|
| Q |
118 |
ggatgaaagagaaattgaagggataatattctcccaatataaatgttccatattcttagcataattcttaacttacaatgggaaactaaataaatgcatt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31879471 |
ggatgaaagagaaattgaaggaataatattctcccaatataaatgttccatattcttagcataattcttaacttacaatgggaaactaaataaatgcatt |
31879372 |
T |
|
| Q |
218 |
ggagaagct-tttacagg |
234 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
31879371 |
ggagaagctctttacagg |
31879354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University