View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16507_low_23 (Length: 360)
Name: NF16507_low_23
Description: NF16507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16507_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 108 - 351
Target Start/End: Original strand, 36159666 - 36159904
Alignment:
| Q |
108 |
tctattgcatttaagcttctgtttggcatttctggaaaatgatttatgccaccttctcattaatgagaacatgcaatagtttatcatgagcttgaaaatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36159666 |
tctattgcatttaagcttctgtttggcatttctggaaaatgatttatgccaccttctcattaatgagaacatgcaatagtttatcatgagcttgaaaatg |
36159765 |
T |
|
| Q |
208 |
attatgcataaaaatattgtttgtcagcctgtctaaagcatgacaacaggactaaactctatgcatcagaaaatagtaataacatatcagaaaatctcaa |
307 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36159766 |
attatgcataaaaatattgtttgacagcctgtctaaagcatgacaacagg-----actctatgcatcagaaaatagtaataacatatcagaaaatctcta |
36159860 |
T |
|
| Q |
308 |
ctcaaaattgtaagaatataaaaaggatgtatatgccatatggg |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36159861 |
ctcaaaattgtaagaatataaaaaggatgtatatgccatatggg |
36159904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 108 - 273
Target Start/End: Original strand, 36153903 - 36154076
Alignment:
| Q |
108 |
tctattgcatttaagcttctgtttggcatttctggaaaatg-----------atttatgccaccttctcattaatgagaacatgcaatagtttatcatga |
196 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
36153903 |
tctaatgcatttaagtttctgtttggcatttctggaaaatataatcaactatatttatgccaccttctcatttatgagaacatgcaaccgtttatcatga |
36154002 |
T |
|
| Q |
197 |
gcttgaaaatgattatgcataaaaa-tattgtttgtcagcctgtctaaagcatgacaacaggactaaactctatgcat |
273 |
Q |
| |
|
||| | |||| |||||| ||||||| || ||||||||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
36154003 |
gctaggaaataattatgtataaaaagta----ttgtcagcctggctaaagcatgacaaccggactaaaccctatgcat |
36154076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University