View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16507_low_35 (Length: 251)
Name: NF16507_low_35
Description: NF16507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16507_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 62 - 237
Target Start/End: Original strand, 3314996 - 3315171
Alignment:
| Q |
62 |
aaatttgactatgattatatttgtgtggtacataaataaatttataattggaccagtgtcaacctcaattactctgcattaaccaacaatactaataaca |
161 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3314996 |
aaattttactatgattatatttgtgtggtacataaataaatttataattggaccagtgtcaacctcaattactctgcattaaccaacaatactaataaca |
3315095 |
T |
 |
| Q |
162 |
attcaaataatgtaaccacnnnnnnnntattgctttatatattaagttggtatactacatttcatcatatagaaac |
237 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
3315096 |
attcaaataatgtaaccacaaaaaaaatattgctttatatattaagtttgtatactacatttcatcacatagaaac |
3315171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University