View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16507_low_36 (Length: 250)
Name: NF16507_low_36
Description: NF16507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16507_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 15 - 235
Target Start/End: Complemental strand, 24620387 - 24620166
Alignment:
| Q |
15 |
agagacagagtgaaattcaagaggaattgataaggaagcaagaagagatggcaaagaaacagtaagagactaatgtcgggatagcggctcttctggacat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24620387 |
agagacagagtgaaattcaagaggaattgataaggaagcaagaagagatggcaaagaaacagtaagagactaatgtcgggatagcggctcttctggacat |
24620288 |
T |
|
| Q |
115 |
gatgaagaag-aaacatcaaccttagaaccttagttgcacaaccttcattttagcttatcatgttttatctttgcttctgaatatttgtgcttctgatat |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24620287 |
gatgaagaagaaaacatcaaccttagaaccttagttgcacaaccttcattttagcttatcatgttttatctttgcttctgaatatttgtgcttctgatat |
24620188 |
T |
|
| Q |
214 |
attgttgtctttgatacaattt |
235 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24620187 |
attgttgtctttgatacaattt |
24620166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 165
Target Start/End: Original strand, 24497269 - 24497321
Alignment:
| Q |
113 |
atgatgaagaagaaacatcaaccttagaaccttagttgcacaaccttcatttt |
165 |
Q |
| |
|
||||||||||| |||| |||||||||| ||||||||||||| |||| ||||| |
|
|
| T |
24497269 |
atgatgaagaaacaacaacaaccttagacccttagttgcacacccttgatttt |
24497321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University