View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16507_low_40 (Length: 208)

Name: NF16507_low_40
Description: NF16507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16507_low_40
NF16507_low_40
[»] chr7 (1 HSPs)
chr7 (15-185)||(21469245-21469415)


Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 185
Target Start/End: Original strand, 21469245 - 21469415
Alignment:
15 gagatgaatgtgtgaaagttttcgatggatcttctacaaatgatcaacatgaaagtaatcgttctaacgaagaacaagtcgaagggatgaaacattcatg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21469245 gagatgaatgtgtgaaagttttcgatggatcttctacaaatgatcaacatgaaagtaatcgttctaacgaagaacaagtcgaagggatgaaacattcatg 21469344  T
115 tccaacatcaagcagcagcaacacaaatatgaaattgcattactcttctaatagttctacaacactaaagt 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21469345 tccaacatcaagcagcagcaacacaaatatgaaattgcattactcttctaatagttctacaacactaaagt 21469415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University