View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16508_high_12 (Length: 424)
Name: NF16508_high_12
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16508_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 10 - 312
Target Start/End: Complemental strand, 47358941 - 47358642
Alignment:
| Q |
10 |
gcacagacaattaagcatgaaccaaacttaaaatggtgagtttgctttttagactggagaaataaaaacaattaagacgtacgtacagcgtgcacggcag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358941 |
gcacagacaattaagcatgaaccaaacttaaaatggtgagtttgctttttagactggagaaataaaaacaattaagacgtacgtacagcgtgcacggcag |
47358842 |
T |
|
| Q |
110 |
gggaagaagtagacattgtttttaatgcatgcctttgtgattgtggttgatgatgatacagcaccattacattattacatgatgagtaccctaaagtttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
47358841 |
gggaagaagtagacattgtttttaatgcatgcctttgtgattgtggttgatgatgatgcagcactattac---attacatgatgagtaccctaaagtttt |
47358745 |
T |
|
| Q |
210 |
gctattatagataaacataaacatgcatgcatgtggttcatcatcactgtccttttaggccatctctggtgggtctgcctgacttgtaaagctttgtaca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47358744 |
gctattatagataaacataaacatgcatgcatgtggttcatcatcactgtccttttaggccatctctggtgggtctgcctgacttgtaaagctttgtata |
47358645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 335 - 384
Target Start/End: Complemental strand, 47358649 - 47358600
Alignment:
| Q |
335 |
gtataaatatttgcatcttctttttcttcaactttataattaaatcatat |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358649 |
gtataaatatttgcatcttctttttcttcaactttataattaaatcatat |
47358600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University