View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16508_high_23 (Length: 298)
Name: NF16508_high_23
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16508_high_23 |
 | |
|
| [»] scaffold0147 (2 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 1763359 - 1763076
Alignment:
| Q |
1 |
caaccatagctagatgctgtcctaaacatacacgaggtcccattccaaatggcatgtaaacttgtggaatcttgcatgctccatgcactccatttgcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1763359 |
caaccatagctagatgctgtcctaaacatacacgaggtcccattccaaatggcatgtaaacttgtggaatcttgcatgctccatgcactccatttgcaaa |
1763260 |
T |
|
| Q |
101 |
tctttctggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttggaatttgg |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1763259 |
tctttccggattgaacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttggaatttgg |
1763160 |
T |
|
| Q |
201 |
atacctttgaaattaatgtcttcaaaagcctgtctaacaaccgataatgctggtggataaagcctcaatgtctcttgaatcacc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1763159 |
atacctttgaaattaatgtcttcaaaagcctgtctaacaaccgataatgctggtggataaagcctcaatgtctcttgaatcacc |
1763076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 213
Target Start/End: Complemental strand, 25197782 - 25197611
Alignment:
| Q |
42 |
attccaaatggcatgtaaacttgtggaatcttgcatgctccatgcactccatttgcaaatctttctggattgaacttatgtgcatcatgtccccaaagct |
141 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||||| | |||| |||| ||||||| ||||||||| || ||||| | |||||||| ||||| | | |
|
|
| T |
25197782 |
attccaaatggcatataagcttgtggaaacttgcaggatccaagcacaccatttgaaaatctttcaggtttgaattcgtgtgcatcgaccccccatatat |
25197683 |
T |
|
| Q |
142 |
ctgggtcttgatgcaatattggcattggaatttgaagattcattccttttggaatttggatacctttgaaat |
213 |
Q |
| |
|
| ||||| || ||||| || |||||||| |||| | | |||||||||||||||| ||||||||| |||| |
|
|
| T |
25197682 |
ccttgtcttcctgaaatatcgggattggaatctgaatagtgattccttttggaattttgataccttttaaat |
25197611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 14 - 208
Target Start/End: Complemental strand, 10603 - 10409
Alignment:
| Q |
14 |
atgctgtcctaaacatacacgaggtcccattccaaatggcatgtaaacttgtggaatcttgcatgctccatgcactccatttgcaaatctttctggattg |
113 |
Q |
| |
|
|||||||||| ||| ||||||| || |||||||||||||| ||| |||||||||||||||| |||| | |||| ||||||||||||||||| |||||| |
|
|
| T |
10603 |
atgctgtcctggacagacacgagaaccgattccaaatggcatataagcttgtggaatcttgcaggctctaagcacaccatttgcaaatctttcaggattg |
10504 |
T |
|
| Q |
114 |
aacttatgtgcatcatgtccccaaagctctgggtcttgatgcaatattggcattggaatttgaagattcattccttttggaatttggataccttt |
208 |
Q |
| |
|
|||| |||||||| ||||||| || ||| || ||||||||||| |||||||| |||| ||||||||||||||||| || ||||||||| |
|
|
| T |
10503 |
aactcgtgtgcatcggccccccaaatatcaatgtcatgctgcaatattgggattggaatctgaatattcattccttttggaactttgataccttt |
10409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 248 - 284
Target Start/End: Complemental strand, 10369 - 10333
Alignment:
| Q |
248 |
tgctggtggataaagcctcaatgtctcttgaatcacc |
284 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10369 |
tgctggcggataaagcctcaaagtctcttgaatcacc |
10333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 42 - 222
Target Start/End: Complemental strand, 19208315 - 19208135
Alignment:
| Q |
42 |
attccaaatggcatgtaaacttgtggaatcttgcatgctccatgcactccatttgcaaatctttctggattgaacttatgtgcatcatgtccccaaagct |
141 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||| |||||| |||| ||||||||||||||||| |||||||||| |||||||| | ||||| | | |
|
|
| T |
19208315 |
attccaaatggcatataagcttgtggaatcttgcaggctccaagcacaccatttgcaaatctttcaggattgaactcgtgtgcatcgggcccccagatat |
19208216 |
T |
|
| Q |
142 |
ctgggtcttgatgcaatattggcattggaatttgaagattcattccttttggaatttggatacctttgaaattaatgtctt |
222 |
Q |
| |
|
| |||||| |||||||| | |||||||| || | ||| ||||||||||||| || ||||||||| |||||||| |||| |
|
|
| T |
19208215 |
caatgtcttgttgcaatatcgcaattggaatctgcatattaattccttttggaactttgataccttttaaattaatatctt |
19208135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 248 - 284
Target Start/End: Complemental strand, 19208109 - 19208073
Alignment:
| Q |
248 |
tgctggtggataaagcctcaatgtctcttgaatcacc |
284 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19208109 |
tgctggtggataaagcctcaaagtctcttgaatcacc |
19208073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University