View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16508_high_38 (Length: 234)
Name: NF16508_high_38
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16508_high_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 11 - 215
Target Start/End: Complemental strand, 30273575 - 30273367
Alignment:
| Q |
11 |
tagattatacttacctcttg----gttgtgattacaggcagtgataaagaggttgatgactgatgtgccttttggtgttctactatctggaggtttggac |
106 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30273575 |
tagattttacttacctcttggttggttgtgattacaggcagtgataaagaggttgatgactgatgtgccttttggtgttctactatctggaggtttggac |
30273476 |
T |
|
| Q |
107 |
tcatcattggttgcatccatcacttctcgctacctagcaaccactaaagctgctgaacaatggggatcaaaattacactcattctgcgttggccttgagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30273475 |
tcatcattggttgcatccatcacttctcgctacctagcaaccactaaagctgctgaacaatggggatcaaaattacactcattctgcgttggccttgagg |
30273376 |
T |
|
| Q |
207 |
tgcatatat |
215 |
Q |
| |
|
||||||||| |
|
|
| T |
30273375 |
tgcatatat |
30273367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 35 - 192
Target Start/End: Complemental strand, 25966510 - 25966353
Alignment:
| Q |
35 |
tgattacaggcagtgataaagaggttgatgactgatgtgccttttggtgttctactatctggaggtttggactcatcattggttgcatccatcacttctc |
134 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||| || |||||| ||||||||||||||||||| || |||||||||||| | ||||| || |
|
|
| T |
25966510 |
tgattacaggctgtgataaaaaggttgatgactgatgtgccgttcggtgttttactatctggaggtttggattcttcattggttgcagcagtcactgcta |
25966411 |
T |
|
| Q |
135 |
gctacctagcaaccactaaagctgctgaacaatggggatcaaaattacactcattctg |
192 |
Q |
| |
|
| ||||| || ||| ||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
25966410 |
gatacctggctggcacaaaagctgctaaacaatggggagcaaaattacactcattctg |
25966353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University