View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16508_high_41 (Length: 227)
Name: NF16508_high_41
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16508_high_41 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 121 - 227
Target Start/End: Complemental strand, 1763550 - 1763444
Alignment:
| Q |
121 |
attgagaaccctaacaaaaatgagaaaatctttatagttttacatttgtcatgatcattagatttttgtcatgtgaagagcaactccatggccaggttct |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1763550 |
attgagaaccccaacaaaaatgagaaaatctttatagttttacattggtcatgatcattagatttttgtcatgtgaagagcaactccatggccaggttct |
1763451 |
T |
 |
| Q |
221 |
acaagca |
227 |
Q |
| |
|
||||||| |
|
|
| T |
1763450 |
acaagca |
1763444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 6 - 83
Target Start/End: Complemental strand, 1763624 - 1763547
Alignment:
| Q |
6 |
actacatccatttaaaattgaaaagtcaaactagaaatattgaactgaatgatacatcatcgacaaatgtgtatattg |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1763624 |
actacatccatttaaaattgaaaagtcaaactagaaatattgaactgaatgatacatcatcgacaaatgtgtatattg |
1763547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University