View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16508_low_18 (Length: 394)
Name: NF16508_low_18
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16508_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 14 - 388
Target Start/End: Original strand, 41538564 - 41538938
Alignment:
| Q |
14 |
ggttatagttacaattctagtcctagatggagaagtttagaggtttcgaagaataaggatttaggttatggctgttggaatcagtgtttgcagaggcctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41538564 |
ggttatagttacaattctagtcctagatggagaagtttagaggtttcgaagaataaggatttaggttatggctgttggaatcagtgtttgcagaggcctt |
41538663 |
T |
|
| Q |
114 |
tgtataggtttttgttgaggacgttgttgttttgtccgatggcagcttcagttaagaatgtttctcaggtgttttatgtttggattagttatttggagcc |
213 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41538664 |
tgtataggtttttgctgaggacattgttgttttgtccgatggcagcttcagttaagaatgtttctcaggtgttttatgtttggattagttatttggagcc |
41538763 |
T |
|
| Q |
214 |
ttggagtattaagggtgatgagttttcggagcttgatgcaatgaacggtgaaaaaatggaaaatgctgtgtctgaaattggaagtggtggtggtggtgca |
313 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41538764 |
ttggagtattaagggtgatgagttttcagagcttgatgcaatgaacggtgaaaaaatggaaaatgctgtgtctgaaattggaagtggtggtggtggtgca |
41538863 |
T |
|
| Q |
314 |
tattctccgcgttgggtggattatgttctatctaattatctgtattatacttcactggttatgcatattcttgga |
388 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
41538864 |
tattcgccgcgttgggtggattatgttctatctaattatctgtattatacttcactggttatgcattttattgga |
41538938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University