View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16508_low_27 (Length: 297)
Name: NF16508_low_27
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16508_low_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 13 - 297
Target Start/End: Complemental strand, 41538245 - 41537961
Alignment:
| Q |
13 |
gagaagaagcgtgtagaaatcatagttaggttgatcgtttgacacggggggttttgtggcggagacaaatggaatcgaagaagtccaattttctaaccta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41538245 |
gagaagaagcgtgtagaaatcatagttaggtctatcgtttgacacggggggttttgtggcggagacaaatggaatcgaagaagtccaattttctaaccta |
41538146 |
T |
 |
| Q |
113 |
gatttcgcagcggtggtgattttaacggaagattgatcggaatttgttggattgacggaattacccttggaaacggggtaataagcgaaccagaaaaaga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41538145 |
gatttcgcagcggtggtgattttaacggaagattgatcggaatttgttggattgacggaattacccttggagacggggtaataagcgaaccagaaaaaga |
41538046 |
T |
 |
| Q |
213 |
agtattgaaaaacattgagttgaatttgtgaagaggaagatgaagatgggaagactgatggcagaagatcggagagattgtgttt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41538045 |
agtattgaaaaacattgagttgaatttgtgaagaggaagatgaagatgggaagactgatggaagaagatcggagagattgtgttt |
41537961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University