View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16508_low_37 (Length: 262)
Name: NF16508_low_37
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16508_low_37 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 35044720 - 35044972
Alignment:
| Q |
1 |
aaaacatcaatttccattaacagttgatgcccatgaataactgatttgattctaggataacatatttttatatagaaagttgcttgatctcataaa---- |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35044720 |
aaaacatcaatttccattaacagttgatgcccatgaataactgatttgattctaggataacatatttttatatagaaagttgcttgatctcataaagtaa |
35044819 |
T |
|
| Q |
97 |
-gtagcataattaaacttttgattattattatacaaggaagatattccataattcgtattttgcattcacacatacgtacaactttaaaattccaagcta |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35044820 |
agtagcataattaaacttttgattattattatacaaggaagatattccataattcgtattttgcattcacacatacgtacaactttaaaattccaagcta |
35044919 |
T |
|
| Q |
196 |
ctgagaacacataaatcagaaattagaatttatttttgtgagtagtcaaatct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35044920 |
ctgagaacacataaatcagaaattagaatttatttttgtgagtagtcaaatct |
35044972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University