View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16508_low_38 (Length: 257)
Name: NF16508_low_38
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16508_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 179
Target Start/End: Original strand, 697402 - 697454
Alignment:
| Q |
127 |
tatgtctatcaaagcctatgtcgataaactcgttagagaaattcaacaattcg |
179 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
697402 |
tatgtctatcaaagcctctgtcgataaactcgttagagaaattcaacagttcg |
697454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 59
Target Start/End: Original strand, 697119 - 697153
Alignment:
| Q |
25 |
tctagtaataaaagtaagaagtgttttgatcatga |
59 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
697119 |
tctagtaataaaagtaagaagtcttttgatcatga |
697153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 181
Target Start/End: Original strand, 699516 - 699548
Alignment:
| Q |
149 |
gataaactcgttagagaaattcaacaattcgga |
181 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
699516 |
gataaactcgctagagaaattcaacaattcgga |
699548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University