View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16508_low_46 (Length: 229)
Name: NF16508_low_46
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16508_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 41537728 - 41537937
Alignment:
| Q |
1 |
ccctcgctttcccagccctaatctgcaacctcttcggcttcgaaaacccacgcgccgcctcaccttcatccaacggttggatcaacatccccgagcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41537728 |
ccctcgctttcccagccctaatctgcaacctcttcggcttcgaaaacccacgcgccgcctcaccttcatccaacggttggatcaacatccccgagcttca |
41537827 |
T |
 |
| Q |
101 |
caaacccctcttctctctcctctcccccaccgggaccctcgccaccgccatcaccgccgtcgaccgtctctccctcgttaaatatcttttccccgccgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41537828 |
caaacccctcttctctctcctctcccccaccggaaccctcgccaccgccatcaccgccgtcgaccgtctctccctcgttaaatatcttttcccctccgaa |
41537927 |
T |
 |
| Q |
201 |
cgtcttcctc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
41537928 |
cgtcttcctc |
41537937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 17402312 - 17402242
Alignment:
| Q |
1 |
ccctcgctttcccagccctaatctgcaacctcttcggcttcgaaaacccacgcgccgcctcaccttcatcc |
71 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||||||| |||| |||||||||| ||| | |||||||||||| |
|
|
| T |
17402312 |
ccctcgttttcccaaccctaatctacaacctcttaagcttaaaaaacccacgtgccacttcaccttcatcc |
17402242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University