View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16508_low_48 (Length: 217)
Name: NF16508_low_48
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16508_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 200
Target Start/End: Original strand, 49784949 - 49785136
Alignment:
| Q |
13 |
ataatactcatagaaactcataagatgatatgtcgatcaacttttacgtccgacaatgatctctttcttatatgttgcgtgaatatgccgagaaacaaat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49784949 |
ataatactcatagaaactcataagatgatatgtagatcaacttttacatccgacaatgatctctttcttatatgttgcgtgaatatgacgagaaacaaat |
49785048 |
T |
|
| Q |
113 |
gaacattgtttcacagttgctggttccttctaatttaaagaatgttgaaggttgacggttgaactatttcatcgactaagttattagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
49785049 |
gaacattgtttcacagttgctggttccttctaatttaaagaatgttgaaggttgacggttgaactacttcgtcgactaagttattagt |
49785136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University