View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16508_low_49 (Length: 210)
Name: NF16508_low_49
Description: NF16508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16508_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 39 - 178
Target Start/End: Original strand, 49216822 - 49216957
Alignment:
| Q |
39 |
aattgttgagttttggatgaattgttaccactcttgaaattcatgatgaagcacacaacaaaagaagnnnnnnnntagaagaagcaaagttggaatggaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||| ||||||||| |||||||||||||| ||||||||||||||||| ||||| | |
|
|
| T |
49216822 |
aattgttgagttttggatgaattgttaccactgataaaattgatgatgaagtacacaacaaaagaa----aaaaatagaagaagcaaagttgaaatggca |
49216917 |
T |
 |
| Q |
139 |
gcaatagaggaagaaattgttactgttgaaattgatgatg |
178 |
Q |
| |
|
| || |||||||||||||||||| |||||||||||||||| |
|
|
| T |
49216918 |
ggaagagaggaagaaattgttaccgttgaaattgatgatg |
49216957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 196
Target Start/End: Complemental strand, 32369187 - 32369136
Alignment:
| Q |
148 |
gaagaaattgttac---tgttgaaattgatgatgagacttatgaagaaattg |
196 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32369187 |
gaagaaattgttacaactgttgaaattgatgatgagacatatgaagaaattg |
32369136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University