View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16510_high_9 (Length: 261)
Name: NF16510_high_9
Description: NF16510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16510_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 423808 - 423607
Alignment:
| Q |
1 |
tctcattcatattatagtcatagtcatagctagccagccagacatatatgaattaatcatgacgatcatctgacctgggtaccactgatcatcaaacaga |
100 |
Q |
| |
|
|||||||||||| |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
423808 |
tctcattcatatcatagtcatagc--tagccagccagccagacatatatgaattaatcatgacgatcatctgacctgggtaccactgatcatcaaacaga |
423711 |
T |
 |
| Q |
101 |
ccaaactcaaaacagattgtgggtcccatctaatttaatgtctcagatt------attaaccccatccaatccattctcacccgttcactgtccttgttt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
423710 |
ccaaactcaaaacagattgtgggtcccatctaatttaatgtctcagattattattattaaccccatccaatccattctcacccgttcactgtccttgttt |
423611 |
T |
 |
| Q |
195 |
atta |
198 |
Q |
| |
|
|||| |
|
|
| T |
423610 |
atta |
423607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University