View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16511_high_16 (Length: 417)
Name: NF16511_high_16
Description: NF16511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16511_high_16 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 18 - 396
Target Start/End: Original strand, 35106663 - 35107041
Alignment:
| Q |
18 |
ccgtggatggccctgaaatgtttatccgaattgcaaaaccattctattcaaagactggcatgagatttattattttgctttggggagaaaaatcagacct |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35106663 |
ccgtggatggccctgaaatgtttaaccgaattgcaaaaccattctattcaaagactggcatgagatttattattttgctttggggagaaaaatcagacct |
35106762 |
T |
|
| Q |
118 |
gaatctgatcgctgaagaaaataaggaggtcccaatctttagtttcatggaagtcatagatttgggacgagagagtcgcatggcattgtctgattctcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35106763 |
gaatctgatcgctgaagaaaataaggaggtcccaatctttagtttcatggaagtcatagatttgggacgagagagtcgcatggcattgtctgattctcat |
35106862 |
T |
|
| Q |
218 |
gaagctagtaagtcgacttttttctcttcaaactcgggttatattatacttaagaattatcgatcaatactatttgaaaatttaataatatatggtcccc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35106863 |
gaagctagtaagtcgacttttttctcttcaaactcgggttatattatacttaagaattgtcgatcaatactatttgaaaatttaataatatatggtcccc |
35106962 |
T |
|
| Q |
318 |
cacctccttgagaattcaacaatatatggtcctctcaaatgaaaaattgtccttgttgcaagttctaacatttctttta |
396 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35106963 |
caccttcttgagaattcaacaatatatggtcctctcaaatgaaaaattgtccttgttgcaagttgtaacatttctttta |
35107041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 417
Target Start/End: Complemental strand, 20440586 - 20440556
Alignment:
| Q |
387 |
atttcttttaggcttaattacacttttggtc |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20440586 |
atttcttttaggcttaattacacttttggtc |
20440556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 47 - 112
Target Start/End: Complemental strand, 38121875 - 38121810
Alignment:
| Q |
47 |
attgcaaaaccattctattcaaagactggcatgagatttattattttgctttggggagaaaaatca |
112 |
Q |
| |
|
|||||||||||||| |||| ||||| || |||||||||||| |||||||||||||||||||| |
|
|
| T |
38121875 |
attgcaaaaccattttatttgaagacctcaatcagatttattattctgctttggggagaaaaatca |
38121810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University