View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16511_high_31 (Length: 265)
Name: NF16511_high_31
Description: NF16511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16511_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 240
Target Start/End: Original strand, 34657672 - 34657897
Alignment:
| Q |
15 |
aagaatatctcaaaaagtctaaggttatcaaaatagactcnnnnnnntcatgggaacattacatctcttatgctaccaatcaaagttaccccgtaagtct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34657672 |
aagaatatctcaaaaagtctaaggttatcaaaatagactcaaaaaaatcatgggaacattacatctcttatgctaccaatcaaagttaccccgtaagtct |
34657771 |
T |
 |
| Q |
115 |
tctttgtttatgaaaaatcatttaacttactgcatatttgaaattacactgagtttcacaagatcatagtgacaccgtaattttgttacagctctggtca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34657772 |
tctttgtttatgaaaaatcatttaacttactgcatatttgaaattacactgagtttcacaagatcatagtgacaccgtaattttgttacagctctggtcg |
34657871 |
T |
 |
| Q |
215 |
atagattttgtcaaaatcacggtacc |
240 |
Q |
| |
|
|||| |||||||||||||||| |||| |
|
|
| T |
34657872 |
ataggttttgtcaaaatcacgatacc |
34657897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University