View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16511_high_34 (Length: 249)
Name: NF16511_high_34
Description: NF16511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16511_high_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 12216111 - 12215889
Alignment:
| Q |
19 |
agatggttagtgtgttgtagctttaaataagaagttagggaannnnnnnggctaaatgatatttatttgacagcattacggagtgtgaagatctatgtag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12216111 |
agatggttagtgtgttgtagctttaaataagaagttagggaatttttttggctaaatgatatttatttgacagcattacggagtgtgaagatctatgtag |
12216012 |
T |
 |
| Q |
119 |
caccgacacttttacagcacagtcatatgtgattacattaaatcactactgttttctcaagttatttttggtttatgtgccagtgttggtagtgtgtgtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12216011 |
caccgacacttttacagcacagtcatatgtgattacattaaatcactactgttttctcaagttatttttggtttatgtgccagtgttggtagtgtgtgtc |
12215912 |
T |
 |
| Q |
219 |
cttcccatgtttgtgcctatgct |
241 |
Q |
| |
|
||| ||||||||||| ||||||| |
|
|
| T |
12215911 |
ctttccatgtttgtgtctatgct |
12215889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University