View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16511_low_21 (Length: 375)
Name: NF16511_low_21
Description: NF16511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16511_low_21 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 256 - 375
Target Start/End: Complemental strand, 25475996 - 25475877
Alignment:
| Q |
256 |
tctccataggtaccacaattgtcgcatatgatctcccccatctctaatccatggatcataccatcctcttattctcgacccatcatcaactctcaattta |
355 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25475996 |
tctccataggtaccgcaggtgtcacatatgatctcccccatctctaatccatggatcataccatcctcttattctcgacccatcatcaactctcaattta |
25475897 |
T |
 |
| Q |
356 |
aggtctcctctaactactac |
375 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
25475896 |
aggtcttctctaactactac |
25475877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University