View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16511_low_27 (Length: 337)
Name: NF16511_low_27
Description: NF16511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16511_low_27 |
 | |
|
| [»] scaffold0072 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0072 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 329
Target Start/End: Original strand, 41652 - 41980
Alignment:
| Q |
1 |
cctaaccacaaaaggccacccagttaaaaacatcactagatctgagatgatgctgagaagagaaaaaggattatgttattattgtgatgaacgattctct |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41652 |
cctacccacaaaaggccacccagttaaaaacatcactagagctgagatgatgctcagaagagaaaaaggattatgctattattgtgatgaacgattctct |
41751 |
T |
|
| Q |
101 |
atatctcataaatgtccaaatcgtcattatttcttatttcaaactaaagaagaagaagaacctgacccaccaccaccgcaaatcacaccatcaactgacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
41752 |
atatctcataaatgtccaaatcgtcattatttcttattccaaactgaagaagaagaagaacctgaaccaccaccacaacaaatcacaccatcagctgacc |
41851 |
T |
|
| Q |
201 |
ctgaaacaccacctattgttacggaggagcaccacttgtcactgaatgccttgaacggttctgctcgtaaaggcaccatgcggttccacggtcaaattca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41852 |
ctgaaacaccacctattgttacggaggagcaccacttgtcactgaatgccttgaacggttctgctcgtaaaggcaccatgcggttccacagtcaaattca |
41951 |
T |
|
| Q |
301 |
gggtattgctatcacgattttcttggaca |
329 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
41952 |
gggtattgctatcacgattttgttggaca |
41980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 117
Target Start/End: Original strand, 8596019 - 8596080
Alignment:
| Q |
56 |
agaagagaaaaaggattatgttattattgtgatgaacgattctctatatctcataaatgtcc |
117 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| |||||| | |||||||||||||| |
|
|
| T |
8596019 |
agaagagaaaaaggtttatgttatttttgtgatgagaaattctcattttctcataaatgtcc |
8596080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University