View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16511_low_42 (Length: 235)
Name: NF16511_low_42
Description: NF16511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16511_low_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 87 - 207
Target Start/End: Original strand, 42003624 - 42003744
Alignment:
| Q |
87 |
gagaattacagattcaaacgtacgtctcaatggtcttgccacctaccaattgattacgagactagatttaaatcgatagttatgatttttgttttgaaac |
186 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003624 |
gagaattacagattcaaacgtacgtcttaacggtcttgccacttaccaattgattacgagactagatttaaatcgatagttatgatttttgttttgaaac |
42003723 |
T |
|
| Q |
187 |
gtagtggttaggttaatattt |
207 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42003724 |
gtagtggttaggttaatattt |
42003744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 45
Target Start/End: Original strand, 42003536 - 42003566
Alignment:
| Q |
15 |
gagaagaattggatgaatggtaattccatgc |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42003536 |
gagaagaattggatgaatggtaattccatgc |
42003566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University