View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16511_low_44 (Length: 228)
Name: NF16511_low_44
Description: NF16511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16511_low_44 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 228
Target Start/End: Original strand, 39461203 - 39461418
Alignment:
| Q |
15 |
aaccaacacctagctgtgaaattgataaatttgaatggattggaatgaaagtaaaaccttgatatggattagttcctcaaacattgagatctttttctgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39461203 |
aaccaacacctagctgtgaaattgataaatttgaatggattggaatgaaaataaaaccttgatatggattagttcctcaaacattgagatctttttctgg |
39461302 |
T |
 |
| Q |
115 |
gatattttcgacgacatcttacgttggggccaatttactgatga-ttcggcttactattatttactaaaaatgatt-aaacaattaagcaaatgagagaa |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39461303 |
gatattttcgacgacatcttatgttggggtcaatttactgatgatttcggcttactattatttactaaaaatgattaaaacaattaagcaaatgagagaa |
39461402 |
T |
 |
| Q |
213 |
atgaattacatggaac |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39461403 |
atgaattacatggaac |
39461418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 64
Target Start/End: Complemental strand, 34329830 - 34329794
Alignment:
| Q |
28 |
ctgtgaaattgataaatttgaatggattggaatgaaa |
64 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34329830 |
ctgtgaaattgataaatttgaatggatcagaatgaaa |
34329794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University