View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16511_low_45 (Length: 227)
Name: NF16511_low_45
Description: NF16511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16511_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 10618567 - 10618353
Alignment:
| Q |
1 |
gcggtgttgcagaggttgatgatgggggagaaggatacacaggagtgttattggttgggtgctgttcatgttaaagatgttgctagagctcatgttttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10618567 |
gcggtgttgcagaggttgatgatgggggagaaggatacacaggagtgttattggttgggtgctgttcatgttaaagatgttgctagagctcatgttttgg |
10618468 |
T |
|
| Q |
101 |
tttacgagactccaactgctgctggtagatatctttgtgttaatggtatctatcagttttctagttttgccaaaattgtctctgaattgtaccctgatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10618467 |
tttacgagactccaactgctgctggtagatatctttgtgttaatggtatctatcagttttctagttttgccaaaattgtctctgaattgtaccatgatta |
10618368 |
T |
|
| Q |
201 |
ccctattcacaggtt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10618367 |
ccctattcacaggtt |
10618353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University