View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16512_high_14 (Length: 268)
Name: NF16512_high_14
Description: NF16512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16512_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 1221474 - 1221304
Alignment:
| Q |
14 |
ctatatatgaatgtttattgttatgagcaaagtttgctcccnnnnnnnnngtctatttggcattttattactattccatattattaatgactacccaaca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1221474 |
ctatatatgaatgtttattgttatgagcaaagtttgctccctttttttt-gtctatttggcattttattactattcgatattattaatgactacccaaca |
1221376 |
T |
 |
| Q |
114 |
atgatcgtcttttcttttatacaaactcaacaatgatcattatagaggatggtatgcaacctttatcattat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1221375 |
atgatcgtcttttcttttatacaaactcaacaatgatcattatagaggatggtatgcaacctttatcattat |
1221304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 183 - 252
Target Start/End: Complemental strand, 1221204 - 1221135
Alignment:
| Q |
183 |
tatcagaatcctcataaatcccccatgtcgacnnnnnnnggtttagcaaattaaagccattgttgctaat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1221204 |
tatcagaatcctcataaatcccccatgtagacaaaaaaaggtttagcaaattaaagccattgttgctaat |
1221135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 74 - 185
Target Start/End: Original strand, 41987108 - 41987219
Alignment:
| Q |
74 |
cattttattactattccatattattaatgactacccaacaatgatcgtcttttcttttatacaaactcaacaatgatcattatagaggatggtatgcaac |
173 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41987108 |
cattttattactattcgatattattaatgactacccaacaatgatcgtcttttcttttatacaaactcaacaatgatcattatagaggatggtatgcaac |
41987207 |
T |
 |
| Q |
174 |
ctttatcattat |
185 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41987208 |
ctttatcattat |
41987219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 54
Target Start/End: Original strand, 41986963 - 41987002
Alignment:
| Q |
14 |
ctatatatgaatgtttattgttatgagcaaagtttgctccc |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41986963 |
ctatatatgaatgtttattgttatgagcaaa-tttgctccc |
41987002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University