View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16512_high_18 (Length: 222)
Name: NF16512_high_18
Description: NF16512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16512_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 4065456 - 4065259
Alignment:
| Q |
17 |
tcattcttatattaaagtgtgtcctgatcatgttggaattaaatattttcatatctcactcacttatctcttcttcaa-ttattttatcttttctttgat |
115 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
4065456 |
tcattcttatatttaagtgcgtcctgatcatgttggaattaaatattttcatatcttactcacttatctcttcttcaaattattttatcttttcttggat |
4065357 |
T |
|
| Q |
116 |
aaataagctcgaattattcttatacttgtacaaatcaaagctcttcttttattctttaacactttcaacctttgttaagaaaatattatatgcaaact |
213 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065356 |
caataagctcgaattattcttatacttgcacagatcaaagctcttcttctattctttaacactttcaacctttgttaagaaaatattatatgcaaact |
4065259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University