View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16513_high_6 (Length: 467)
Name: NF16513_high_6
Description: NF16513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16513_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 4e-48; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 18 - 147
Target Start/End: Complemental strand, 28699719 - 28699591
Alignment:
| Q |
18 |
gtacttggggcgtgttgtggagccatacttatatagacaaggtcatcataactgcttccatgcaatcttgcaacagatgcatgactaagttaagagatcg |
117 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||| |
|
|
| T |
28699719 |
gtacttggggcgtgtcgtggagccacacttatatagacaacgtcatcataactgcttccatgcaatctagcaacagatgcatgagtaagtt-agagatcg |
28699621 |
T |
|
| Q |
118 |
gttcaacgattaagatcagcctgagatgat |
147 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
28699620 |
gttcaacggttaagatcagcctgagatgat |
28699591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 28696808 - 28696763
Alignment:
| Q |
186 |
tagtcattgagattgatatatttagcaaaaagaaagtacatttcaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28696808 |
tagtcattgagattgatatatttagcaaaaagaaagtacatttcaa |
28696763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 18 - 153
Target Start/End: Complemental strand, 28684414 - 28684287
Alignment:
| Q |
18 |
gtacttggggcgtgttgtggagccatacttatatagacaaggtcatcataactgcttccatgcaatcttgcaacagatgcatgactaagttaagagatcg |
117 |
Q |
| |
|
|||| |||||||||| ||||||||| ||||||| ||||||| ||||| ||| |||| |||| || |||||||||||| | ||||| ||||||| |
|
|
| T |
28684414 |
gtacctggggcgtgtcgtggagccacacttata-------ggtcatcgtaactactttcatgaaatccagcgacagatgcatgagttagtta-gagatcg |
28684323 |
T |
|
| Q |
118 |
gttcaacgattaagatcagcctgagatgatgttcct |
153 |
Q |
| |
|
|||||||||||||||| | |||||| || ||||||| |
|
|
| T |
28684322 |
gttcaacgattaagattaacctgaggtggtgttcct |
28684287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University