View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16513_low_17 (Length: 365)
Name: NF16513_low_17
Description: NF16513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16513_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 35 - 262
Target Start/End: Complemental strand, 6455734 - 6455507
Alignment:
| Q |
35 |
acctaagtgaattttgaagtggttgtggtaaatttggtctctcatcagctgaagaattagctccatgcaaaggaacaatattaatcccttgtgtctgcag |
134 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6455734 |
acctaagtgaattttgaagtggttgaggtaaatttggtctctcatcagctgaagaattagctccatgcaaaggaacaatattaatcccttgtgtctgcag |
6455635 |
T |
|
| Q |
135 |
tatcccatgacctgcaaaatttcattgctcttactttatcagacacattaacttaataattcatcacatcatcacttcaattgaaaatcataaagttata |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6455634 |
tatcccatgacctgcaaaatttcattgctcttactttatcagacacattaacttaataattcatcacatcataacttcaattgaaaatcataaagttata |
6455535 |
T |
|
| Q |
235 |
ctatagtttctgtcaaatccaaatatct |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
6455534 |
ctatagtttctgtcaaatccaaatatct |
6455507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 6455474 - 6455417
Alignment:
| Q |
295 |
ttgtgcaataattaatagaagaaattatgaaaatataattacctgctcctgatttgtc |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6455474 |
ttgtgcaataattaatagaagaaattatgaaaatataattacctgctcctgatttgtc |
6455417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University