View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16513_low_22 (Length: 338)
Name: NF16513_low_22
Description: NF16513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16513_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 16 - 254
Target Start/End: Original strand, 32377241 - 32377479
Alignment:
| Q |
16 |
acatcatcgctttgaatgacatcaaggaaaggagtaaggtaaatggaaggatcgatagtgcgccattcttgttgaggattgaatatgagagaacggagag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377241 |
acatcatcgctttgaatgacatcaaggaaaggagtaaggtaaatggaaggatcgatagtgcgccattcttgttgaggattgaatatgagagaacggagag |
32377340 |
T |
 |
| Q |
116 |
accttaaagaattaataatggaagaatcgtaggattcttcaggagaagatatgttgtagacaggagtaaattcgggataacgtcgtatcactgctagaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377341 |
accttaaagaattaataatggaagaatcgtaggattcttcaggagaagatatgttgtagacaggagtaaattcgggataacgtcgtatcactgctagaac |
32377440 |
T |
 |
| Q |
216 |
tgcaccaacttcagtgcttaacatgcatgagagtcctag |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377441 |
tgcaccaacttcagtgcttaacatgcatgagagtcctag |
32377479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University