View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16513_low_30 (Length: 249)
Name: NF16513_low_30
Description: NF16513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16513_low_30 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 73 - 249
Target Start/End: Complemental strand, 1712595 - 1712411
Alignment:
| Q |
73 |
caagttagttgaataatgaatttataa--------gttaaaaaggtttgaaactaatttttattttgagacaagttttatctcaacttcaaattaaaacc |
164 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1712595 |
caagttagttgaataatgaatttataaaaacagttgttaaaaaggtttgaaactaatttttattttgagacaagttttatctcaacttcaaattaaaacc |
1712496 |
T |
 |
| Q |
165 |
tactatttagacaaaaacaattatcttcaaaagcatccaaaataacatgtcaacatcaattttataatcctagaatcacttttac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1712495 |
tactatttagacaaaaacaattatcttcaaaagcatccaaaataacatgtcaacatcaattttataatcctagaatcacttttac |
1712411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 46
Target Start/End: Complemental strand, 1712645 - 1712610
Alignment:
| Q |
11 |
atgaagccaacaaatataaaatcaaggcaacgtaac |
46 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1712645 |
atgaagccaacaactataaaatcaaggcaacgtaac |
1712610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University