View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16513_low_32 (Length: 240)
Name: NF16513_low_32
Description: NF16513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16513_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 12608192 - 12607983
Alignment:
| Q |
19 |
tatagtactattatataccttgaatttgcgacagaaattaacatcactccaatgtatttcatccaaatcaggttctatggttttacgatcttccctccaa |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12608192 |
tatagtactgttatataccttgaatttgcgacagaaattaacatcactccaatgtatttcatccaaatcaggttctatggttttacgatcttccctccaa |
12608093 |
T |
|
| Q |
119 |
accacagcagttgctgaggatgtgaacacaactttgtctattgtttctgtttgagcacaagcttcaagcacgttgtgtgctgctctaacttccacgtcag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12608092 |
accacagcagttgctgaggatgtgaacacaactttgtctattgtttctgtttgagcacaagcttcaagcacgttgtgtgctgctctaacttccacgtcag |
12607993 |
T |
|
| Q |
219 |
ccatatattc |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
12607992 |
ccatatattc |
12607983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University