View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16513_low_33 (Length: 227)
Name: NF16513_low_33
Description: NF16513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16513_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 37 - 211
Target Start/End: Original strand, 2179538 - 2179710
Alignment:
| Q |
37 |
ctaaaaatggaatcgaagtacaacttgatagccacaaaaagacaaaacacattcacttgtctcctttttgttcttgttgtgaaagtatagtctcctcaca |
136 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2179538 |
ctaaaaatagaatcgaagtacaacttgatagccacaaaaagacaaa-cacattcacttgtctcctttttgttcttgttgtgaaagtattgtctcctcaca |
2179636 |
T |
 |
| Q |
137 |
aaactaattnnnnnnnntctgnnnnnnnaacacaaaatgactctcttttttagaggacaaaaagactcttctaag |
211 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2179637 |
aaactaatt-aaaaaaatctgtttttttaacacaaaatgactctcttttttagaggacaaaaagactcttctaag |
2179710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University