View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16514_high_20 (Length: 216)
Name: NF16514_high_20
Description: NF16514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16514_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 40883250 - 40883051
Alignment:
| Q |
1 |
aaccacctatccctcacgatgtaagcctctttttcacttcgctttcgttcttctactctgtctgcatagagacagaagttaaaaggtagaatgaagaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40883250 |
aaccacctatccctcacgatgtaaacctctttttcacttcgcttttgttcttctactctgtctgcatagagacagaagttaaaaggtagaatgaagaagg |
40883151 |
T |
|
| Q |
101 |
accgactccgagtagtatgtgtctttgacgacaatgatatttgtcttacacagtgaaagcaagacgctgcgacattgcccatcgtggcagaggaatttat |
200 |
Q |
| |
|
||||| || ||||||||| |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40883150 |
accgattctgagtagtatttgtctttgacgacaatgatatttgtcttacgcggtgaaagcaagacgctgcgacattgcccatcatggcagaggaatttat |
40883051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 8908754 - 8908944
Alignment:
| Q |
1 |
aaccacctatccctcacgatgtaagcctctttttcacttcgctttcgttcttctactctgtctgcatagagacagaagttaaaaggtagaatgaagaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8908754 |
aaccacctatccctcacgatgtaaacctctttttcacttcgcttttgttcttctactctgtctgcatagagacagaagttaaaag-tagaatgaagaagg |
8908852 |
T |
|
| Q |
101 |
accgactccgagtagtatgtgtctttgacgacaatgatatttgtcttacacagtgaaagcaagacgctgcgacattgcccatcgtggcagag |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8908853 |
accgactccgagtagtatttgtctttgacgacaatgatatttgtcttacacggtgaaagcaagacactgtgacattgcccatcgtggcagag |
8908944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 8891271 - 8891308
Alignment:
| Q |
1 |
aaccacctatccctcacgatgtaagcctctttttcact |
38 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8891271 |
aaccacctatccctcacgatgtaaacctctttttcact |
8891308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University