View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16514_low_17 (Length: 301)
Name: NF16514_low_17
Description: NF16514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16514_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 24 - 283
Target Start/End: Complemental strand, 52246080 - 52245821
Alignment:
| Q |
24 |
ggatgaacacaaaaatgttcaattccacttttcaaattcaaaccccctcccaacatattaaatttcggttttataaccattttaccaaggttnnnnnnnn |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52246080 |
ggatgaacacaaaaatgttcaattccacttttcaaattcaaaccccctcccaacatattaaatttcggttttataaccattttaccaaggttaaaaaaca |
52245981 |
T |
 |
| Q |
124 |
nnnnnnnnntatttccaaattcaacttttttcatactattgcgtagtgaaattatgaaaaacctgaccagttcccaaagtgggagaatctttgggaccat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52245980 |
aaataaaaatatttccaaattcaacttttttcatactattgcgtagtgaaattatgaaaaacctgaccagttcccaaagtggtagaatctttgggaccat |
52245881 |
T |
 |
| Q |
224 |
agactgtaaatttactgtcaaagcttttgcagcagatttaacaagacttttggttagtct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52245880 |
agactgtaaatttactgtcaaagcttttgcagcagatttaacaagactttttgttagtct |
52245821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University