View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16514_low_21 (Length: 263)
Name: NF16514_low_21
Description: NF16514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16514_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 2 - 246
Target Start/End: Complemental strand, 36435660 - 36435415
Alignment:
| Q |
2 |
gagtttgtaacaatgtaaaagtcatggagaatttggggaaaaataacctttcggacaataaaaa-tcctagtcgtcattgatttggaggaaaagactcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||| || ||||||||||||||||||||||||| |
|
|
| T |
36435660 |
gagtttgtaacaatgtaaaagtcattgagaatttggggaaaaataacctttcggacaataaaaaattctaggcgccattgatttggaggaaaagactcaa |
36435561 |
T |
 |
| Q |
101 |
cttcttcgttttatttttgttttgattgatctctcgtgttctaagtcaattctaagatgaatatcatcacttaatattgaaggaccacatttataacgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36435560 |
cttcttcgttttatttttgttttgattgatctctcgtgttctaagtcaattctaagatcaatatcatcacttaatattgaaggaccacatttttaacgtt |
36435461 |
T |
 |
| Q |
201 |
tgtaacacgagatgctggatacacttctaatagtaatcttttgaag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36435460 |
tgtaacacgagatgctggatacacttctaatagtaatcttttgaag |
36435415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University