View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16514_low_22 (Length: 254)
Name: NF16514_low_22
Description: NF16514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16514_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 72 - 165
Target Start/End: Complemental strand, 42236047 - 42235954
Alignment:
| Q |
72 |
taggattgatggatgtggtaatggggtggtggaagtcgaaggatcagacattgtttagatttggcatgagatttggtgagtgaattaatgaatt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236047 |
taggattgatggatgtggtaatggggtggtggaagtggaaggatcagacattgtttagatttggcatgagatttggtgagtgaattaatgaatt |
42235954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University