View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16514_low_24 (Length: 243)
Name: NF16514_low_24
Description: NF16514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16514_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 47 - 147
Target Start/End: Original strand, 7314257 - 7314357
Alignment:
| Q |
47 |
gatagggttccatgcggtaagatgggttggagtgagagaaggaagagagagatatatacttgcggtttggagacggcgcgcggtgttgtggtggagaaga |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
7314257 |
gatagggttccatgcggtaagatgggttggagtgagagaaggaagagagagatatatacttgcggtttggagacggcgcgcggttttgtggtggaggaga |
7314356 |
T |
|
| Q |
147 |
a |
147 |
Q |
| |
|
| |
|
|
| T |
7314357 |
a |
7314357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 190 - 241
Target Start/End: Original strand, 7314351 - 7314402
Alignment:
| Q |
190 |
aggagcagaggttttcactttttgatggagaagagctacacgtacgattgcc |
241 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
7314351 |
aggagaagaggttttcagtttttgatggagaagagctacacatacgattgcc |
7314402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University