View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16514_low_25 (Length: 229)
Name: NF16514_low_25
Description: NF16514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16514_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 215
Target Start/End: Complemental strand, 29006234 - 29006025
Alignment:
| Q |
6 |
atcaccataaacaacaggtatgtagacaactggtgtcaattaaagctccaacttgcttcttgaccccctgacccttgtctttggattcattatttatttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29006234 |
atcaccataaacaacaggtatgtagacaactggtgtcaattaaagctccaacttgcttcttgaccccctgacccttgtctttggattcattatttatttt |
29006135 |
T |
 |
| Q |
106 |
ttatgtcggggccactaggaatcagagttacatttgtttgctttatgtgacaacttctcattcttagtttgatatgagatgtatagtatgggtatttgga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29006134 |
ttatgtcggggccactaggaatcagagttacatttgtttgctttatgtgacaacttctcattcttagtttgatatgagatgtatagtatgggtatttgga |
29006035 |
T |
 |
| Q |
206 |
ggtgcctatg |
215 |
Q |
| |
|
|||||||||| |
|
|
| T |
29006034 |
ggtgcctatg |
29006025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University