View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16514_low_26 (Length: 221)
Name: NF16514_low_26
Description: NF16514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16514_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 28546203 - 28546016
Alignment:
| Q |
17 |
aaaatgtcaaagttgcatgcgacaaagcaaaaagacaaattgcaaacatttcagataatcctgtattcacataccagacaaattgcacaaattctttctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
28546203 |
aaaatgtcaaagttgcatgcgacaaagcaaaaagacaaattgcaaacatttcagataatcttgtattcacataccagacaaattgcacaagttccttctt |
28546104 |
T |
 |
| Q |
117 |
gactttgatcagctgaacagtatagtgtttttgtcaaatacttagaaatcaaactctcagataatcctgtattcacatagccgatcct |
204 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28546103 |
gactttgctcagctgaacagtacagtgtttttgtcaaatacttagaaatcaaactctcagataatcctgtattcacatagccgatcct |
28546016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 87 - 186
Target Start/End: Complemental strand, 28531939 - 28531840
Alignment:
| Q |
87 |
ataccagacaaattgcacaaattctttcttgactttgatcagctgaacagtatagtgtttttgtcaaatacttagaaatcaaactctcagataatcctgt |
186 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| ||||||||||| || | ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28531939 |
ataccagacaaattgcacaagttccttcttgactttgctcagctgaacaatacaatgtttttgtcaaatacttagaaatcaaaccctcagataatcctgt |
28531840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University