View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16515_high_46 (Length: 326)
Name: NF16515_high_46
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16515_high_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 6 - 310
Target Start/End: Original strand, 49086265 - 49086569
Alignment:
| Q |
6 |
ctagattattcttgccttattcgtcgtctttcttaatgaaggtgtttgcttgctcctaaattccatttgaagtatgaacaattttgctctctttgcaaat |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49086265 |
ctagattatttttgccttattcgtcgtctttcataatgaaggtgtttgcttgctcctaaattccatttgaagtatgaacaattttgctctctttgcaaat |
49086364 |
T |
|
| Q |
106 |
aaataaatggtgtaaaaattgaatgtgacgtgttgtgggatctgtcgaagcatgagaaccaaacatgtgtagaactatactaaacacacataatcaatag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49086365 |
aaataaatggtgtaaaaattgaatgtgacgtgttgtgggatctggcgaagcatgagaaccaaacatgtgtagaactatactaaacacacataatcaatag |
49086464 |
T |
|
| Q |
206 |
tgagcaaaccaattttcattgaatgcagaaactgttggttttataagtctataagtttatccaaatgtcggtgaaacgactcgatctaagccacgtctcc |
305 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49086465 |
tgagcaaaccaattttcattgcatgcagaaactgttggttttataagtctataagtttatccaaatgtcggtgaaacgacccgatctaagccacgtctcc |
49086564 |
T |
|
| Q |
306 |
ttcat |
310 |
Q |
| |
|
||||| |
|
|
| T |
49086565 |
ttcat |
49086569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University