View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16515_high_60 (Length: 287)
Name: NF16515_high_60
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16515_high_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 192 - 280
Target Start/End: Original strand, 31223744 - 31223832
Alignment:
| Q |
192 |
caacctttcttatacttctgatttctcaggaccatttatttactatattttccccaaatcaagatacattgtatttgtcacctatgctt |
280 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31223744 |
caaccattcttatacttctgatttctcaggaccatttatttactatattttccccaaatcaagatacattgtatttgtcacctttgctt |
31223832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University