View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16515_high_68 (Length: 270)
Name: NF16515_high_68
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16515_high_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 19 - 262
Target Start/End: Complemental strand, 39934230 - 39933987
Alignment:
| Q |
19 |
ctaacaaacattgatgaggctagttagcgtgttgtaattagttacagttagtaaaccaatgtagaaagttagttagagtactgttacacatctatgtagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39934230 |
ctaacaaacattgatgaggctagttagcgtgttgtaattagttacagttagtaaaccaatgtagaaagttagttagagtactgttacacatctatgtagc |
39934131 |
T |
 |
| Q |
119 |
tataaatacatgtatgatgtcacattttcacttagatgagaaatcataaattgtcattaatttcttcagtacctttctctcaatctagttcctaaattca |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39934130 |
tataaatacatgtatgatgtcacattgtcacttagatgagaaatcataaattgtcattaatttcttcagtacctttctctcaatctagttcctaaattca |
39934031 |
T |
 |
| Q |
219 |
gtttcttgatgtagattatttgtgacatacattgcatctgtgct |
262 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39934030 |
gtttctggatgtagattatttgtgacatacattgcatctgtgct |
39933987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University