View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16515_high_69 (Length: 265)
Name: NF16515_high_69
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16515_high_69 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 69 - 192
Target Start/End: Complemental strand, 33604609 - 33604485
Alignment:
| Q |
69 |
ctgaaaatagtaagagctcgcctttaaaccgttaaaacccttgattgtgtgttccattgcttaaa-tcaaactagatattcaaaatctctagtttaatat |
167 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
33604609 |
ctgaaaatagtaagagctcacctttaaaccgttaaaacccttgattgtgtgttccattgcttaaattcaaactagatattcaaagtctctagtttaatat |
33604510 |
T |
 |
| Q |
168 |
ttaacgaaaattcaaaaattacatc |
192 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33604509 |
ttaacgaaaattcaaaaattacatc |
33604485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 217 - 250
Target Start/End: Complemental strand, 33604466 - 33604433
Alignment:
| Q |
217 |
aaagaaacatcatatgttctattactcaaatttt |
250 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
33604466 |
aaagaaacatcatatgttctattgctcaaatttt |
33604433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University