View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16515_high_85 (Length: 228)

Name: NF16515_high_85
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16515_high_85
NF16515_high_85
[»] chr2 (2 HSPs)
chr2 (148-228)||(32689404-32689484)
chr2 (1-87)||(32689261-32689343)


Alignment Details
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 148 - 228
Target Start/End: Original strand, 32689404 - 32689484
Alignment:
148 atatagtatgacggattattatcaccagccatactattacttacgaaannnnnnngctagtgatccgccagaaatgtacat 228  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||| ||       ||||||||||||||||||||||||||    
32689404 atataatatgacggattattatcaccaaccatactattacttacggaaattttttgctagtgatccgccagaaatgtacat 32689484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 32689261 - 32689343
Alignment:
1 actaaactctagtaaaatgttaattcgagccgatttcaaggcnnnnnnnnngcctattttcaacacaatgctaatttttcacttctt 87  Q
    ||||||||||||||||||| |||||||||||||||| |||           ||||||||||||||||||||||||||||||||||||    
32689261 actaaactctagtaaaatgctaattcgagccgattttaag----tttttttgcctattttcaacacaatgctaatttttcacttctt 32689343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University