View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16515_low_31 (Length: 401)
Name: NF16515_low_31
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16515_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 16 - 395
Target Start/End: Original strand, 30480432 - 30480815
Alignment:
| Q |
16 |
ataaatacacccatcctttctgctataataataccttaatacaagcaatcactcaaagctagcttcaattatatagattcttatactttatatatatcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30480432 |
ataaatacacccatcctttctgctataataataccttaatacaagcaatcactcaaagctagcttcaattatatagattcttatactttatatatatcca |
30480531 |
T |
|
| Q |
116 |
cacctctaccatatatatccaaaatttcaaaaatatatcttcctctttctcttcctagcttacaa----aattaatcatgggtcttagagatgtcggtgc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30480532 |
cacctctaccatatatatccaaaatttcaaaaatatatcttcctctttctctccctagcttacaaaattaattaatcatgggtcttagagatgtcggtgc |
30480631 |
T |
|
| Q |
212 |
ttcacttccccctggctttcgattttaccctagtgatgaagagttggtccttcattacctttacnnnnnnntcactaatgaggatgttcttaagggtacc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30480632 |
ttcacttccccctggctttcgattttaccccagtgatgaagagttggtccttcattacctttacaaaaaaatcactaatgaggatgttcttaagggtacc |
30480731 |
T |
|
| Q |
312 |
ttggaggaaattgacttgcatacttgcgagccttggcaacttcctggtatatattatatttatcatcattttcacttcatctct |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30480732 |
ttggaggaaattgacttgcatacttgcgagccttggcaacttcctggtatatattatatttatcatcattttcacttcatctct |
30480815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University