View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16515_low_33 (Length: 386)
Name: NF16515_low_33
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16515_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 85 - 369
Target Start/End: Original strand, 26577783 - 26578067
Alignment:
| Q |
85 |
ataaggatgattgttgaccttatctagctaatgcttataacctgcacacatgaacacacagttagtagagatatattattcctttgctttaatttgttat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
26577783 |
ataaggatgattgttgaccttatctagctaatgcttataacctgcacacatgaacacacagttagtagagatat--tactcctttgctttaatttgttat |
26577880 |
T |
 |
| Q |
185 |
catcaaaatattatgatcctcttagaattttaattaatagaccttcttttatgagttgatggtaattacccta--cctagttctccttttgatttttgat |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26577881 |
catcaaaatattatgatcctcttagaattttaattaatagaccttcttttatgagttgatggtaattaccctagacctagttctccttttgatttttgat |
26577980 |
T |
 |
| Q |
283 |
ttgtcaaacatcaacacaaagggtttgacagtaatagtgatgacatctcgagtattggatcttgagcttctacataagggtcttgtt |
369 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26577981 |
ttgtcaaacatcaatacaaagggtttgacagtaatagtgatgacatctcaagtattggatcttgagcttctacataagggtcttgtt |
26578067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 14 - 49
Target Start/End: Original strand, 26577712 - 26577747
Alignment:
| Q |
14 |
attattctttatgtctagataatggacatggttgta |
49 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26577712 |
attattctttatgtctagataatgggcatggttgta |
26577747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University