View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16515_low_37 (Length: 375)
Name: NF16515_low_37
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16515_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 218 - 358
Target Start/End: Original strand, 47626527 - 47626667
Alignment:
| Q |
218 |
tcttggatgcttacatttcctcgtcgtggtgttcgatatctgaaagggtggaggaaatgatggaattggaattatgtgcaagggattgaagggaagaagg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47626527 |
tcttggatgcttacatttcctcgtcgtggtgttcgatatcagaaagggtggaggaaatgatggaattggaattctgtgcaagggattgaagggaagaagg |
47626626 |
T |
 |
| Q |
318 |
gttaatgcaagaatgttgttggaattgaaggagtgtagagt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47626627 |
gttaatgcaagaatgttgttggaattgaaggagtgtagagt |
47626667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 21 - 151
Target Start/End: Original strand, 47626326 - 47626456
Alignment:
| Q |
21 |
taagcattgcataaaatcgaatcacaaagttaagaaaatagagaaaattgttacctcgaagctcagaaacaatggagggatgataaatcatgaatcccaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47626326 |
taagcattgcataaaatcgaatcacaaagttaagaaaatagcgaaaattgttacctcgaagctcagaaacaatggagggatgataaatcatgaatcccaa |
47626425 |
T |
 |
| Q |
121 |
acatttcaagccttgtgcagctctaacaaac |
151 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
47626426 |
acatttcaaggcttgtgcagctctaacaaac |
47626456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University