View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16515_low_66 (Length: 286)
Name: NF16515_low_66
Description: NF16515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16515_low_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 55 - 265
Target Start/End: Original strand, 35342060 - 35342277
Alignment:
| Q |
55 |
tgacttgtgtttttggcaatcaagtcatgtagcaatcgtggcatttgaattatgccactcatgaatttatttatatttgnnnnnnnnctt-------ctt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||| |
|
|
| T |
35342060 |
tgacttgtgtttttggcaatcaagtcatgtagcaatcgtggcatttgaattatgccgctcatgaatttatttatatttgttttttttttttttctttctt |
35342159 |
T |
 |
| Q |
148 |
aaatctaatctttgtaacttccgttttgattgaaaataatagatgttttttaggttctcatgagaattatggtgatccacgaatacaaggataagggtaa |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35342160 |
aaatctaatctttgtaacttccgttttgattgaaaataatagatgttttttaggttctcatgagaattatggtgatccacggatacaaggataagggtaa |
35342259 |
T |
 |
| Q |
248 |
aatattccctagacggcc |
265 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
35342260 |
aatattccttagacggcc |
35342277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 35341935 - 35341991
Alignment:
| Q |
1 |
tgatttggtgaagattcgcttgacttccttataatttaattcattgatcattgatga |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35341935 |
tgatttggtgaagattcgcttgacttccttataatttaattcattgatcattgatga |
35341991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University